2A) and accordingly led to significant increase of the STIM1 and Orai1 transcript levels insgk1+/+BMMCs but not insgk1/BMMCs (Fig. subunits p65/p50 or p65/p52. They were decreased by silencing of NF-B subunits p65, p50, or p52 or by NF-B inhibitor Wogonin (100 m). Luciferase assay and chromatin immunoprecipitation defined NF-B-binding sites in promoter regions accounting for NF-B sensitive genomic regulation of STIM1 and Orai1. Store-operated Ca2+access was similarly increased by overexpression of p65/p50 or p65/p52 and Ac2-26 decreased Ac2-26 by treatment with Wogonin. Transfection of HEK293 cells with p65/p50 or p65/p52 further augmented migration. The present observations reveal powerful genomic regulation of Orai1/STIM1 by SGK1-dependent NF-B signaling. Keywords:Calcium Channels, Cell Signaling, Gene Expression, NF-B Transcription Factor, Phosphatidylinositol 3-Kinase, Protein Kinases, Serine Threonine Protein Kinase, Transcription Factors, Transcription Regulation == Introduction == Alterations of cytosolic Ca2+activity participate in the regulation of a wide variety of cellular functions including excitation-contraction coupling, exocytosis, migration, cell proliferation, and cell death (14). Cytosolic Ca2+is usually increased by release of Ca2+from intracellular stores and/or Ca2+access across the cell membrane (5). Ca2+release from intracellular stores results in the activation of Ca2+release-activated Ca2+channel (CRAC)2(6,7), which consists of the pore forming models Orai1, -2, and/or -3 (810) and the endoplasmic reticulum-located regulatory subunit STIM1 or -2 (1113). The activation of the channel leads to the inward currentICRACand the store-operated Ca2+access (SOCE). Recent observations uncovered the powerful activation ofICRACand SOCE by the serum and glucocorticoid-inducible kinase SGK1 (14), a kinase stimulated by growth factors and involved in stress response (15) and regulation of cell survival (16). SGK1 is usually partially effective through phosphorylation of the ubiquitin ligase Nedd4-2 (neuronal precursor cellsexpresseddevelopmentallydown-regulated). Nedd4-2 ubiquitinates Orai1, thus preparing the channel protein for degradation (14). The effect of Nedd4-2 on Orai1 parallels that of Nedd4-2 around the epithelial Na+channel ENaC (16,17). The phosphorylation of Nedd4-2 prospects to binding of the ubiquitin ligase to the protein 14-3-3, which prevents the interaction with the channel protein (18). Accordingly, SGK1 enhances Orai1 protein large quantity in Rabbit polyclonal to c Fos the cell membrane (14). STIM is usually similarly regulated by ubiquitination (19). However, the effect of SGK1 on Orai1 protein abundance is only in part explained by Nedd4-2-dependent protein degradation. Therefore, further experiments were performed to explore whether SGK1, in addition, stimulates Orai1 and/or STIM1 expression. As a matter of fact, RT-PCR revealed an increase of Orai1 and STIM1 transcript levels after expression of constitutively active SGK1. Thus, further experiments were performed to uncover the transcription factor involved. Previously, SGK1 has been shown to foster nuclear translocation and activation of nuclear factor B (NF-B) (2022). Accordingly, this study explored the putative involvement of NF-B subunits p65 (RELA), p50 (NFKB1), and p52 (NFKB2) in the regulation of Orai1 and STIM1 expression. == EXPERIMENTAL PROCEDURES == == == == == == Transfection of Cells and NF-B Inhibition == HEK293 cells were transfected with the constitutively active mutant SGK1S422D(hSGK1SDin pIRES-EGFP), the inactive mutant SGK1K127N(hSGK1KNin pIRES-EGFP) (23), or the NF-B subunits p65 (24), p50, and p52 (both obtained from imaGenes GmbH) using FuGENE HD transfection reagent (Roche Diagnostics) according to the manufacturer’s instructions. For luciferase assay, pGL3-Luciferase Enhancer constructs were cotransfected with 50 ng of pRL-TK (Promega) and p65 using FuGENE HD transfection reagent. Where indicated, NF-B was inhibited by treatment of the cells for 24 h with 100 mWogonin (25,26). Additionally, knockdown of NF-B subunits p65, p50, and p52 was performed with 10 nmsiRNA (Life Technology Inc., Ambion) according to the manufacturer’s instructions using Polyplus Interferin (PeqLab, Germany). Mast cells were transfected with 2 g ofS276Dp65 according to the manufacturer’s instructions using answer V and an Amaxa nucleofector device (Kln, Germany; set to program T-020). == Site-directed Mutagenesis == To expose an aspartic acid for any serine at position 276, QuikChange II site-directed mutagenesis kit (Stratagene, Agilent Technologies) was utilized using the following primer pair (5-3 orientation, the mutation is in bold): forward (CAGCTACGGCGGCCTGATGATCGCGAGCTCAGT) and reverse (ACTGAGCTCGCGATCATCAGGCCGCCGTAGCTG). Sequencing was performed to verify Ac2-26 the mutation. == Real-time PCR Analysis.